Sequence Input File Format
Staple and scaffold sequences are input into REVNANO using a plain text file with extension .rev
.
You can see the Paper Examples page for many example sequence input files.
The sequence input file has a simple format:
Comments can be included at any point in the text file by using the symbol #. A comment occupies the entire line it is on.
A keyword
LINEAR
orCIRCULAR
may occur on a separate line anywhere in the text file, and denotes if the scaffold is a closed loop or not. This is most conveniently placed after the scaffold sequence. If this keyword is not specified, the scaffold defaults toLINEAR
.The first nucleic acid sequence encountered in the text file is considered as the scaffold sequence, listed 5’ to 3’.
Subsequent sequences in the text file are considered as staple sequences, each listed 5’ to 3’.
Note
*
pairs must be put around staple sequence regions which are dangles or interior staple loopouts (regions not designed to hybridise with the scaffold). For example: Staple*TTTT*AAATCA*TTTTT*GGTCTTTACCCTGACGATTAGAG*TTTT*
has aTTTT
dangle at both ends marked, and aTTTTT
interior staple loopout region marked.Sequences can written in upper or lower case, or a mixture of both
Sequences will have internal spaces automatically removed
One sequence per line: Sequences split over multiple lines are treated as separate sequences